Olive Leaf Extract (OLE) Impaired Vasopressin-induced Aquaporin-2 Trafcking Los Ntawm Kev Ua Haujlwm Ntawm Calcium-sensing Receptor

Hu rau:tina.xiang@wecistanche.com

Vasopressin (AVP) nce dej permeability hauv cov dejlub raumkhaws cov duct los ntawm kev tswj hwm ntawm aquaporin -2 (AQP2) kev lag luam. Ntau yam kab mob, suav nrog kev kub siab thiab tsis tsim nyog cov tshuaj tiv thaiv kab mob qog noj ntshav (SIADH), yog txuam nrog kev txawv txav hauv dej homeostasis. Nws tau pom tias qee cov phytocompounds muaj txiaj ntsig zoo rau tib neeg kev noj qab haus huv. Ntawm no, cov teebmeem ntawm Olive Leaf Extract (OLE) tau raug tshuaj xyuas siv hauv vitro thiab hauv vivo qauv. Cov kev tshawb fawb Confocal tau pom tias OLE tiv thaiv vasopressin-induced AQP2 translocation mus rau plasma membrane hauv MCD4 hlwb thiab nas.lub raum. Incubation nrog OLE txo qhov AVP-nyob ntawm qhov nce ntawm osmotic dej permeability coefficient (Pf).To elucidate qhov ua tau effectors ntawm OLE, intracellular calcium tau soj ntsuam.OLE nce cov calcium intracellular los ntawm kev ua kom Calcium Sensing Receptor (CaSR).NPS2143. , xaiv CaSR inhibitor, tshem tawm cov nyhuv inhibitory ntawm OLE ntawm AVP-dependent water permeability. Hauv kev sim vivo tau qhia tias kev kho mob nrog OLE nce qhov kev qhia ntawm CaSR mRNA thiab txo qis AQP2 mRNA piv los ntawm kev nce ntawm AQP2-tig miRNA-137. Ua ke, cov kev tshawb pom no qhia tias OLE antagonizes vasopressin kev ua los ntawm stimulation ntawm CaSR qhia tias cov extract no yuav muaj txiaj ntsig zoo rau cov teeb meem tsis zoo uas tshwm sim los ntawm qhov txawv txav CaSR signaling thiab cuam tshuam rau lub raum dej reabsorption.

Txiv ntseej ntoo nplooj tau dav siv los ua cov tshuaj ib txwm siv los kho ntau yam kab mob, tshwj xeeb tshaj yog nyob rau hauv Mediterranean lub teb chaws. Cov nplooj yog feem ntau noj nyob rau hauv tib neeg noj zaub mov raws li ib tug extract los yog hmoov los npaj infusions los yog tshuaj ntsuab tshuaj yej. Kev tshuaj ntsuam xyuas cov yam ntxwv qhia tau hais tias cov txiv ntseej nplooj muaj ntau cov tshuaj bioactive uas tuaj yeem ua rau muaj txiaj ntsig zoo hauv qee yam mob xws li metabolic syndrome, dyslipidemia, thiab ntshav siab.Rau cov neeg mob ntshav siab tseem ceeb, OLE txo cov ntshav siab thiab txo qis glycemia thiab calcemia '. Ntau cov polyphenols xws li oleuropein, hydroxytyrosol, thiab tyrosol tau pom muaj nyob rau hauv ntsuab txiv ntseej nplooj extract (OLE)5, thiab lawv paub tias muaj kev koom tes hauv kev tiv thaiv ntawm qee yam kab mob uas muaj kev ntxhov siab oxidative. Yog li ntawd, nyob rau hauv ob peb xyoos dhau los, kev txaus siab rau kev tshawb fawb txog cov txiaj ntsig zoo ntawm cov txiv ntseej nplooj extract yog nce ntawm cov kws tshawb fawb hauv ntau qhov kev tshawb fawb.OIE tau nthuav tawm cov txiaj ntsig tseem ceeb hauv cov kab mob malignant mesothelioma los ntawm kev hloov pauv intracellular calcium dynamics, tejzaum nws tsom T- hom Ca2 plus channels. Interestingly, OLE tau pom los siv cov tshuaj tiv thaiv kab mob siab rau ntawm caj ces kub siab nyob rau hauv cov nas hypertensive (SHR), muaj feem xyuam rau kev txhim kho vascular muaj nuj nqi *. Cov dej ntau dhau reabsorption plays lub luag haujlwm tseem ceeb hauv pathogenesis ntawm cov ntshav siab. Hauv cov neeg mob ntshav siab, kho nrog txiv ntseej nplooj extract, qhov txo qis ntawm ntau yam mob tshwm sim tau pom muaj cuam tshuam nrog kev txo qis hauv cov ntshav siab. Tsis tas li ntawd, kev tuav dej ntau dhau ua rau muaj ntau yam teeb meem xws li daim siab mob siab, mob plawv tsis ua haujlwm, thiab tsis tsim nyog cov tshuaj tiv thaiv kab mob qog noj ntshav (SIADH). Lub cev dej homeostasis yog nruj tswj hwm los ntawm cov tshuaj antidiuretic hormone vasopressin (AVP) uas tso tawm nyob rau hauv lub cev qhuav dej. AVP khi nws cov cognate V2R receptor nyob rau ntawm lub basolateral membrane ntawmlub raumcov hlwb tseem ceeb yog li ua kom lub cAMP teeb liab txoj hauv kev uas ua rau kev hloov pauv ntawm aquaporin-2(AQP2) bearing vesicles los ntawm lub pas dej intracellular mus rau apical plasma membrane qhov twg dej reabsorption tshwm sim. Ntawm qib molecular, ntau yam tuaj yeem hloov kho lub raum dej sib npaug, Kev nce qib ntawm luminal calcium downregulated lub sij hawm luv luv vasopressin-dependent AOP2 kev lag luam los ntawm kev ua kom cov calcium-sensing receptor (CaSR) 1,12. Ntawm qhov tod tes, CaSR activation nyob rau hauv conditionally immortalized raum proximal tubular epithelial hlwb, cais los ntawm tib neeg cov zis, induced ib tug tseem ceeb nce nyob rau hauv cytosolic calcium thiab txo qhov nce ntawm cAMP elicited los ntawm forskolin (FK), ib tug ncaj activator ntawm adenylate cvclase3 Ntxiv mus. , nyob rau hauv lub raum khaws cov duct MCD4 hlwb, stably qhia cov dej channel AOP2, stimulation ntawm lub CasSR attenuated lub cAMP-nyob rau hauv nce nyob rau hauv AQP2 phosphorylation ntawm serine 256 uas yog ib tug tseem ceeb tshwm sim nyob rau hauv lub teeb liab transduction cascade qhib los ntawm vasopressin thiab nws thiaj li nce dej permeability4. ,15 Tsis tas li ntawd, hauvraumcov hlais los ntawm sab hauv medulla nas lub raum, ua kom lub CaSR nrog cov calcimimetic NPS-R568 ua rau muaj kev nce ntxiv hauv AQP2-targeting miRNA-137, paub meej tias muaj kev sib txuam nruj ntawm CaSR teeb liab txoj hauv kev thiab AQP{ {4}}dependent water permeabilityl.17.Nyob rau hauv txoj kev tshawb no, cov teebmeem ntawm cov txiv ntseej nplooj extract, tau los ntawm lub zos Coratina cultivar, raug soj ntsuam ntawm vasopressin-induced AQP2 muaj nuj nqi nyob rau hauv lub raum sau duct MCD4 hlwb stably qhia AOP2 thiab nyob rau hauv dDAVP kho nas txhaj nrog cov extract. Peb muab pov thawj tias OLE kev kho mob tawm tsam vasopressin cov lus teb hauv lub raum hlwb, uas tuaj yeem piav qhia nws cov nyhuv diuretic. Interestingly, cov nyhuv no zoo li muaj feem xyuam rau OLE-induced activation ntawm CaSR, ib tug receptor paub tias muaj ib tug tsis zoo interplay nrog vasopressin receptorl2.

Kawm ntxiv cov teebmeem ntawm cistanche ntawm lub raum

Cov txiaj ntsig

Cov teebmeem ntawm OLE ntawm vasopressin-induced AQP2 muaj nuj nqi hauv MCD4 hlwb. Txhawm rau tshawb xyuas qhov muaj peev xwm koom tes ntawm OLE ntawm vasopressin-dependent AQP2 muaj nuj nqi,lub raumkhaws cov duct MCD4 hlwb, stably qhia cov vasopressin receptor 2 (V2R) thiab tib neeg AQP2, tau siv los ua tus qauv sim18. Con-focal kev tshawb fawb (Fig. 1A) qhia tias, piv nrog dDAVP kho hlwb, nyob rau hauv uas AQP2 staining localized mus rau apical plasma membrane, kev kho mob nrog OLE tiv thaiv lub membrane localization ntawm AOP2 induced los ntawm stimulation nrog dDAVP. Raws li cov kev soj ntsuam no, OLE kev kho mob cuam tshuam qhov dDAVP-induced nce ntawm lub cev osmotic teb (qhia raws li 1/t hauv Fig.1B)(OLE/dDAVP=88.70±1.86 feem pua ​​, n{16}} cells vs dDAVP{17}}.8 ± 5.49 feem pua ​​,n{21}} cells;p<0.001).altogether these="" findings="" suggested="" that="" treatment="" with="" ole="" reduced="" principal="" cell="" permeability="" by="" preventing="" aqp2="" translocation="" from="" an="" intracellular="" vesicle="" pool="" to="" the="" apical="" plasma="" membrane.="" vasopressin-induced="" aop2="" trafficking="" is="" controlled="" by="" intracellular="" camp="" which="" stimulated="" the="" camp-dependent="" kinase="" (pka)1.="" further,="" to="" evaluate="" the="" functionality="" of="" the="" v2r="" in="" the="" presence="" of="" ole="" in="" terms="" of="" camp="" production,="" permeable="" 8-br-camp="" was="" used="" as="" an="" external="" source="" of="" camp.="" treatment="" with="" 8-br-camp="" abolished="" the="" inhibitory="" effect="" elicited="" by="" ole="" on="" osmotic="" water="" permeability(ole/8-br-camp="188.7±3.56%,n=293" cells="" vs="" ole="85.93±2.27%," n="238"><0.001).therefore, to="" evaluate="" whether="" treatment="" with="" ole="" regulates="" aqp2="" trafficking="" by="" fine-tuning="" intracellular="" camp="" level,="" fluorescence="" resonance="" energy="" transfer(fret)technology="" was="" applied.="" compared="" to="" untreated="" cells="" (ctr),="" normalized="" netfret="" signals="" are="" reduced="" with="" ddavp="" stimulation(ddavp="77.86±3.13%," n="173" cells="" vs="" ctr="100.00±3.56%,n=276" cells;=""><0.00l; fig.2a),consistent="" with="" a="" significant="" increase="" of="" intracellular="" camp.="" conversely,="" treatment="" with="" ole="" prevented="" the="" ddavp="" dependent="" decrease="" of="" netfront="" signals="" consistent="" with="" a="" decrease="" of="" the="" vasopressin="" dependent="" camp="" release="" (ole/ddavp="92.97±3.46%," n="211" cells="" vs="" ddavp="77.86±3.13%," n="173" cells;=""><0.05; fig.2a).treatment="" with="" ole="" alone="" did="" not="" affect="" the="" intracellular="" cgmp="" level="" compared="" with="" cells="" left="" under="" basal="" conditions(ole="96.15±3.80%," n="184" cells="" vs="" ctr="100.00±3.56%,n=276" cells;=""><0.05).besides, western="" blotting="" studies(fig.2b)revealed="" that="" treatment="" with="" ole="" significantly="" reduced="" the="" ddavp="" induced="" increase="" of="" aqp2="" phosphorylation="" at="" serine="" 256(aqp2-ps256),="" indicating="" that="" aqp2="" phosphorylation="" and="" trafficking,="" in="" response="" to="" ole,="" are="" dependent="" on="" camp-pka="" function.="" the="" phosphorylation="" level="" of="" aqp2-ps256="" in="" response="" to="" ole="" was="" not="" statistically="" different="" from="" the="" control="" even="" though="" it="" tended="" to="" be="" reduced.="" to="" gain="" insight="" into="" the="" molecular="" signals="" underlying="" the="" action="" of="" ole,="" intracellular="" calcium="" dynamics="" were="" evaluated.="" mcd4="" cells="" endogenously="" express="" a="" functional="" calcium-sensing-receptor(casr)20,="" which="" plays="" an="" important="" role="" in="" controlling="" aqp2="" expression="" and="" trafficking'4.long="" term="" incubation="" with="" ole(0.1="" mg/ml)slightly="" increased="" the="" intracellular="" calcium="" level="" compared="" with="" untreated="" cells(fig.3;="" ole="209.0±13.45" nm,n="128" cells="" ys="" ctr="163.3±8.957" nm,n="97cells:"><0.05).co-incubation with="" ole(0.1="" mg/ml)="" and="" the="" selective="" nps2143(1um)antagonist="" of="" the="" casr="" abolished="" the="" ole="" induced="" intracellular="" calcium="" mobilization(ole/nps2143="168.8±11.43" nm,n="144" cells="" ys="" ole="209.0+13.45" nm.="" n="128"><0.05).to dissect="" further="" intracellular="" calcium="" signals="" in="" response="" to="" ole,="" functional="" experiments="" were="" also="" performed="" under="" acute="" stimulation="" with="" ole="" and="" nps2143.="" short-term="" treatment="" with="" ole="" (1="" mg/ml)="" evoked="" specific="" calcium="" oscillations(fig.4a)="" that="" were="" prevented="" when="" cells="" were="" pretreated="" with="" the="" selective="" casr="" inhibitor="" nps2143（10="" μm）.="" statistical="" analysis="" of="" the="" fluorescence="" responses（fig.="" 4b）revealed="" that="" incubation="" with="" ole="" increased="" cytosolic="" calcium="" by="" 97.06±6.93%(vs="" atp="" 100.00±2.28%).pretreatment="" with="" nps2143="" reduced="" the="" ole="" induced="" intracellular="" calcium="" increase(ole/nps2143="18.87±2.17%,n=59" cells="" vs="" ole="97.06±6.93%," n="50" cell;=""><0.001).to deeper="" investigate="" whether="" the="" effect="" of="" ole="" on="" avp-dependent="" water="" reabsorption="" occurred="" through="" the="" activation="" of="" the="" casr="" signaling,="" functional="" studies="" were="" performed="" as="" previously="" shown="" (fig.1b).="" interestingly,="" treatment="" with="" nps2143="" abolished="" the="" inhibitory="" effect="" of="" ole="" on="" avp-regulated="" osmotic="" water="" permeability="" (fig.5;="" ole/ddavp/nps2143="190.4±7.15%," n="">cells vs OLE/dDAVP=88.70±1.86 feem pua ​​,n=292 cells;p<0.001), suggesting="" that="" treatment="" with="" ole="" attenuated="" the="" avp-dependent="" water="" reabsorption="" through="" the="" activation="" of="" the="" casr="" signaling.="" compared="" to="" untreated="" cells,="" treatment="" with="" only="" nps2143="" did="" not="" affect="" the="" osmotic="" water="" permeability="" (fig.="">

<0.001 vs="" ctr;=""><0.05 vs="" ddavp).="" (b)="" lysates="" from="" mcd4="" cells="" were="" subjected="" to="" immunoblotting="" using="" abs="" against="" aqp2-ps256="" and="" totalaqp2.="" densitometric="" analysis="" of="" aqp2-ps256="" bands="" normalized="" to="" total="" aqp2="" bands="" (total="" aqp2)="" is="" reported="" in="" the="" histogram.="" data="" are="" expressed="" as="" means±s.e.m=""><0.05 or=""><0.001 vs="" ctr;=""><0.001 vs="" ddavp)."="" alt="Figure 2. Efects of OLE on AQP2 phosphorylation and cAMP production in MCD4 cells. (A) Evaluation of cAMP production by FRET experiments in MCD4 cells transiently transfected with H96 as described in the " materials="" and="" methods"="" section.="" histogram="" reports="" netfret="" measured="" in="" cells="" under="" basal="" conditions,="" treated="" with="" ddavp="" (100 nm="" for="" 30 min),="" ole="" (0.1 mg/ml="" o/n),="" or="" co-treated="" with="" ole="" and="" ddavp.="" te="" treatment="" with="" ddavp="" displayed="" a="" signifcantly="" higher="" camp="" production="" depicted="" as="" a="" reduced="" netfret="" signal.="" data="" are="" shown="" as="" single="" values="" in="" a="" scatter="" plot="" reporting="" means±s.e.m=""><0.001 vs="" ctr;=""><0.05 vs="" ddavp).="" (b)="" lysates="" from="" mcd4="" cells="" were="" subjected="" to="" immunoblotting="" using="" abs="" against="" aqp2-ps256="" and="" totalaqp2.="" densitometric="" analysis="" of="" aqp2-ps256="" bands="" normalized="" to="" total="" aqp2="" bands="" (total="" aqp2)="" is="" reported="" in="" the="" histogram.="" data="" are="" expressed="" as="" means±s.e.m=""><0.05 or=""><0.001 vs="" ctr;=""><0.001 vs="" ddavp)."="" width="480" height="320" border="0" vspace="0" style="width: 480px; height: 320px;">

Cov teebmeem ntawm OLE hauv ob lub raum ntawm nas txhaj tshuaj OLE.

Txhawm rau tshawb xyuas qhov ua haujlwm ntawm OLE, hauv vivo kev tshawb fawb tau ua tiav. Tshwj xeeb, nas tau txhaj tshuaj OLE (250 mg/kg/hnub) ib hnub rau peb hnub. Xwb, nas tau koom nrog OLE, rau 3 hnub, thiab dDAVP, rau 30 min. Kev ntsuam xyuas ntawm CaSR mRNA uas tau cais tawm ntawm lub raum khaws cov duct ntawm nas thiab ua tiav rau lub sijhawm PCR (Fig.6) tau nthuav tawm qhov nce ntxiv ntawm CaSR mRNA hauv OLE(OLE=1.87±0.29, n{{ 10}} nas vs CTR=1.02±0.17, n{15}} nas; p<0.05) and="" ole/ddavp(ole/ddavp="2.77±0.25," n="5" rats="" vs="" ctr="1.02±0.17,n=5" rats="" and="" ddavp="1.08±0.11," n="5" rats;=""><0.001)injected rats="" compared="" with="" control="" and="" ddavp="" animals,="" casr="" signaling="" can="" regulate="" the="" expression="" level="" of="" selective="" mirnas,="" which="" downregulated="" the="" expression="" level="" of="" aqp216.based="" on="" these="" findings,="" and="" considering="" that="" treatment="" with="" ole="" attenuated="" aqp2="" function,="" the="" level="" of="" mir-137,="" a="" known="" aqp2-targeting="" mir="" in="" the="" renal="" collecting="" duct,="" was="" evaluated.="" compared="" to="" control="" rats="" (fig.7),="" the="" level="" of="" mir-137="" in="" the="" renal="" collecting="" ducts="" of="" ole(ole="4.18.10-8±1.07.10-8ng,n=5" rats="" vs="" ctr="1.35.10-8±2.89.10-ng," n="5" rats;=""><0.05)and ole/ddavp="" rats="" was="" increased="" indicating="" that="" treatment="" with="" ole="" upregulates="" the="" casr="" signaling="" and="" the="" expression="" level="" of="" the="" mir-137(ole/ddavp="4.38.10-8±47.01·10-9ng," n="5" rats="" vs="" ctr="1.35.10-8±2.89.10-ng," n="5" rats;=""><0.01 and="" vs="" ddavp="2.1610-8±3.52.10-°ng," n="5"><0.05). to="" verify="" whether="" the="" increase="" of="" mir-137="" affected="" the="" expression="" level="" of="" aqp2,="" renal="" samples="" were="" processed="" for="" real-time="" pcr.="" data(fig.8a)revealed="" that="" the="" expression="" levels="" of="" aqp2="" mrna="" were="" lower="" in="" ole(ole="0.36±0.06,n=5" rats="" vs="" ctr="1.00±0.08," n="5"><0.01)and ole/ddavp(ole/ddavp="0.65±0.12," n="5" rats="" vs="" ctr="1.00±0.08," n="5" rats="" and="" ddavp="1.03±0.16,n=5" rats;=""><0.05)renal samples="" compared="" with="" specimens="" obtained="" from="" control="" animals.="" besides,="" western="" blotting="" analysis(fig.="" 8b)showed="" that="" treatment="" with="" ole="" reduced="" the="" abundance="" of="" aop2="" regardless="" of="" ddavp="" stimulation(ole/ddavp="0.62±0.13,n=5" rats="" vs="" ddavp="1.04±0.16,n=5"><0.05)indicating that="" the="" ole-induced="" reduction="" of="" aqp2="" mrna="" expression="" level="" coincided="" with="" a="" decrease="" of="" aqp2="" protein="" content.="" to="" evaluate="" the="" effect="" of="" ole="" on="" aqp2="" phosphorylation="" and="" trafficking="" in="" the="">raum, Western blotting tsom xam, thiab kev tshawb fawb confocal tau ua tiav (Fig.9). Hauv OLE / dDAVP txhaj nas, phosphorylation ntawm AQP2 ntawm serine 256 tau txo qis dua piv nrog rau cov ntaub so ntswg ntawm dDAVP kho tsiaj (OLE / dDAVP=0. 77±0.16, n=5 nas vs dDAVP=2.16±{10}}.25,n{12}} nas; p<0.001,fig.9a),thereby confirming="" the="" in="" vitro="" findings(fig.2b).="" besides,="" confocal="" studies="" (fig.9b)="" of="" kidney="" sections="" revealed="" that="" exposure="" to="" ole="" prevented="" the="" aop2="" mem-brane="" localization="" that="" instead="" was="" observed="" in="" ddavp="" treated="">

Kev sib tham

Calcium yog ib qho tseem ceeb intracellular tub txib uas modulates plethora ntawm cellular functions2. Cov cim qhia txog calcium uas txawv txav tuaj yeem ua rau ntau yam kab mob xws li lub plawv tsis ua haujlwm, mob qog noj ntshav, thiab ntshav siab23. Kev tswj tshwj xeeb ntawm kev qhia thiab kev ua haujlwm ntawm cov protein tswj ntau cov kab mob hauv lub cev calcium tau ua pov thawj ua tiav kom ntsib ntau yam teeb meem thiab yog li ntawd txaus nyiam rau kev tsim tshuaj. Txoj kev tshawb no muab cov kev nkag siab tshiab rau hauv cov txheej txheem ntawm kev ua ntawm OLE los ntawm kev qhia nws lub peev xwm los hloov kho cov kab mob calcium hauv lub cev los ntawm kev txhawb nqa ntawm CaSR uas koom nrog hauv kev ua kom zoo ntawm vasopressin-induced AQP2 kev lag luam thiab kev qhia. Raws li lub cev muaj zog, AQP2 ua lub luag haujlwm tseem ceeb hauv kev tswj hwm lub cev dej homeostasis25. Kev txhawb nqa ntawm cov tshuab intracellular, ua rau thaj chaw ntawm AQP2 ntawm apical plasma membrane, ua rau cov dej tsis zoo thiab ua rau hyponatremia xws li hauv cov tsos mob ntawm cov tshuaj tsis tsim nyog antidiuretic hormone (SIADH) tso tawm, daim siab mob siab, thiab lub plawv tsis ua haujlwm-. qauv ntawm SIADH, txuam nrog polycystic raum kab mob 1 haploinsufficiency, basal intracellular calcium theem tau txo qis piv rau qib ntsuas hauv cov ducts ntawm cov nas qus. Tsawg intracellular calcium downregulated cov kev ua ntawm tej enzymes nrog rau cov protein phosphatase PP2A uas ua rau lub upregulation ntawm AOP2 phosphorylation ntawm serine 2561. Los ntawm qhov sib txawv. Ua kom cov CaSR nrog cov calcimimetic NPS-R568 nce cov calcium hauv cov cell thiab txo cov qib cAMP hauv PKD1 cov hlwb tsis txaus. Qhov tseem ceeb, cytosolic calcium tuaj yeem txo qis calcium-inhibitable adenylated cyclase3 yog li zoo-tuning theem intracellular ntawm cAMP.In MCD4 hlwb, tseeb, stimulation ntawm CaSR nrog NPS-R568 txo AQP2-pS256 los ntawm inhibition ntawm adenylate. cyclase4.Nyob rau hauv txoj kev tshawb no, kev kho mob nrog OLE tiv thaiv qhov vasopressin-dependent nce ntawm cAMP thiab AOP2-pS256, tej zaum yog theem nrab ntawm kev nce hauv cov calcium hauv cov cell. Ntawm qhov ceeb thawj, raug rau qhov chaw sab nraud ntawm cAMP siv permeable 8-Br-cAMP, ua rau muaj kev cuam tshuam loj heev rau inhibitory nyhuv ntawm OLE ntawm txoj kev V2R.

Ib qib siab ntawm cytosolic calcium tuaj yeem ua rau cell tuag thiab apoptosis. Txawm li cas los xij, ib qho kev nce ntxiv hauv cov calcium hauv cov cell los ntawm 250 nM mus rau ntau dua 600 nM txhawb nqa neuronal survival4.In MCD4 hlwb, kev kho nrog OLE ntawm 0.1 mg / ml tsis pom. ib qho cytotoxic nyhuv. Ntawm qhov concentration no, OLE (0.1 mg / ml) me ntsis nce cov calcium hauv lub cev. Calcium imaging qhia tias mob stimulation nrog OLE ua rau ib ntus nce ntawm intracellular calcium los ntawm kev ua kom CaSR uas raug tshem tawm thaum cov hlwb raug preincubated nrog cov xaiv CaSR antagonist NPS2143, Hauv lub raum proximal tubule hlwb, allosteric activation ntawm CaSR nrog I-ornithine. txo ROS ntau lawm thiaj li txo qis mitochondrial oxidative kev nyuaj siab uas ua rau cell apoptosis356. Ntxiv mus, peb txoj kev tshawb fawb yav dhau los tau pom tias qhov kev qhia ntawm qhov nce-ntawm-kev ua haujlwm sib txawv ntawm CasSR txo ROS tso tawm thiab S-glutathionylation ntawm AQP237. Incubation nrog OLE txo ROS tiam hauv MCD4 hlwb 35 qhia nws lub peev xwm antioxidant. Txawm li cas los xij, tam sim no nws tsis paub meej tias OLE cuam tshuam rau AOP2-S-glutathionylation. Ntau cov kev tshawb fawb tau qhia tias OLE lossis oleuropein, uas yog lub ntsiab lus tseem ceeb ntawm OLE, tuaj yeem muaj lub luag haujlwm tiv thaiv los ntawm inhibiting cell tuag, 39 Txawm li cas los xij, cov teebmeem ntawm koob tshuaj tau piav qhia hauv cov nas uas tau txais OLE. Cov lus teb tau zoo tau txais ntawm koob tshuaj 250 thiab 500 mg / kg. Los ntawm qhov sib txawv, ntawm qhov siab dua, kev kho mob nrog OLE tuaj yeem muaj teeb meem tshwm sim vim yog cov pro-oxidant ua ntawm ntau phytocompounds. Hauv txoj kev tshawb no, nas tau txhaj tshuaj OLE ntawm ib koob ntawm 250 mg / kg rau peb hnub uas qhia txog kev tswj hwm ntawm CaSR. Kev qhia theem ntawm CaSR yog nce los ntawm qee cov tebchaw uas ua raws li allosteric activators ntawm receptor,. Calcimimetics, qhov tseeb, txo qis vascular calcifications los ntawm kev nce biosynthesis ntawm CaSR hauv tib neeg vascular du leeg hlwb0. Hauv qhov kev sib tw no, nws tsis tuaj yeem suav nrog qhov ua tau tias qee qhov sib txuas hauv OLE tuaj yeem ua haujlwm raws li allosteric modulators ntawm CaSR. Ntawm qhov tod tes, kev txhawb nqa nrog vasopressin tuaj yeem ua rau IL -6 tso tawm uas tuaj yeem ua rau nce qib kev qhia ntawm CaSR42.

Nyob rau hauv lub raum, stimulation ntawm lub CaSR signaling yog txuam nrog ib tug downregulation ntawm AQP2 qhia tejzaum nws los ntawm lub miR-137 tiam.miRNAs yog cov pivotal posttranscriptional modulators. Ob peb vasopressin-dependent miRNAs hom phiaj AQP2 qhia kuj tau piav qhia 43. Kev hloov pauv nrog miR-32 thiab miR-137 txo qis kev qhia theem ntawm AOP2 hauv mpkCCDc14 hlwb. Interestingly, OLE tuaj yeem ua rau cov teeb meem inflammatory thiab ua rau muaj kev tiv thaiv los ntawm kev hloov cov kev qhia theem ntawm ob peb miRNAs ", tshwj xeeb, hauv glioblastoma multiforme hlwb, OLE txhawb kev qhia ntawm miRNA sib txawv nrog rau miR-13745 uas koom nrog hauv kev txo qis ntawm lub Akt/mTOR signaling pathway 46. Ntawm kev ceeb toom, kev kho mob nrog oleuropein tiv thaiv Akt/mTOR signaling los ntawm kev ua kom calcium-induced CAMK thiab AMPK".Kev ua kom CaSR nrog NPS-R568 activates AMPK thiab txo mTOR kev ua nyob rau hauv tib neeg proximal tubular cells3. Raws li cov kev tshawb pom no, incubation nrog OLE nce cytosolic calcium, downregulates PKA kev ua, thiab txo cov cyst loj nyob rau hauv 3D-cell kab lis kev cai model48. Ua ke cov kev tshawb pom no qhia tias OLE yuav muaj txiaj ntsig zoo hauv kev kho cov kab mob uas ua rau muaj kev cuam tshuam ntawm intracellular calcium dynamics ntsig txog kev txo qis ntawm CasSR signaling.

Olive nplooj extract muaj ntau yam bioactive Cheebtsam, xws li polyphenols, fibers, thiab minerals49. Lub sijhawm tam sim no, nws tsis paub meej yog tias ib qho kev sib txuas lossis kev sib koom ua ke ntawm phytocompounds hauv OLE yuav muaj txiaj ntsig zoo hauv kev hloov pauv cov lus teb hauv lub cev. Cov extract siv nyob rau hauv txoj kev tshawb no tau siv los ua ib qho khoom noj khoom haus ntxiv thiab yog li ntawd nws yog ib qho tseem ceeb los txheeb xyuas qhov cuam tshuam ntawm lub cev ntawm cov extract nws tus kheej txiav txim siab tias ob peb phenols, suav nrog hydroxytyrosol, yuav raug lim los ntawm lub raum thiab rov qab los ntawm cov zis 50. Cov kev tshawb fawb ntxiv yuav muab qhov ua tau zoo ntawm cov khoom tshwj xeeb uas tuaj yeem tswj hwm cov kab mob calcium hauv lub cev los ntawm CaSR. Txhawm rau txiav txim siab, txoj kev tshawb no muab pov thawj tias OLE tuaj yeem suav tias yog ib qho tshiab muaj peev xwm adjuvant muaj txiaj ntsig los txo cov kev mob tshwm sim los ntawm kev txo qis ntawm CaSR qhia nrog rau kev taw qhia thiab cuam tshuam rau lub raum dej permeability.

Cov ntaub ntawv thiab cov txheej txheem

Tshuaj thiab tshuaj tiv thaiv.Txhua yam tshuaj thiab tshuaj tua kab mob tau yuav los ntawm Merck (Merck KGaA, Darmstadt, Lub teb chaws Yelemees). Calcein-AM, Fura-2-AM, cell culture media, fetal bovine serum (FBS), thiab Super Signal West Pico Chemiluminescent Substrates tau yuav los ntawm Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA).Aquaporin{ {2}}(AQP2) tau kuaj pom siv cov tshuaj tiv thaiv tshwj xeeb (C-tail Ab) tsa tawm tsam cov peptide hluavtaws sib raug rau 15 C-terminal amino acids kawg ntawm tib neeg AQP2!. AQP2-pS256 cov tshuaj tiv thaiv tau txais txiaj ntsig zoo los ntawm Prof Peter Deen. Cov tshis thib ob los tiv thaiv luav horseradish peroxidase-coupled antibodies tau txais los ntawm Merck (Merck KGaA, Darmstadt, Lub teb chaws Yelemees). Ib tug thib ob tshis-tiv thaiv luav tshuaj tiv thaiv ua ke rau Alexa-488 tau yuav los ntawm Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA).

Phenolics-nplua nuj extract ntau lawm thiab tshuaj characterization.Kev tsim cov phenolic-nplua nuj extract los ntawm cov txiv ntseej nplooj tau ua raws li qhia hauv Ranieri li al.35. Tom qab milling nrog ib rab riam (Waring-Commercial, Torrington, CT, USA), ddH2O dej tau ntxiv (piv 1/20, w/y) thiab tom qab ntawd raug ultrasound (CEIA, Viciomaggio, Ltalis) peb zaug , rau 30 min ntawm 35 ± 5 degree txhua lub sijhawm. Thaum kawg, cov extracts tau raug lim los ntawm cov ntawv lim, lyophilized, thiab khaws cia ntawm -20 degree C. Cov extracts tau raug lim nrog nylon lim ntawm 0.45 μm (Merck KGaA, Darmstadt, Lub teb chaws Yelemees) thiab siv rau tshuaj lom neeg yam ntxwv. Tag nrho cov ntsiab lus phenol, kev ua haujlwm antioxidant, thiab kev txheeb xyuas ib qho phenolic compounds tau ua raws li Difonzo li al..The OLE pom cov ntsiab lus ntawm polyphenols, txiav txim siab los ntawm Folin-Ciocalteu, sib npaug rau 195 mg. Gallic acid sib npaug (GAE) thiab kev ua haujlwm antioxidant, txiav txim siab los ntawm ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-}sulfonic acid diammonium ntsev), suav txog 750 μmol TE (Trolox sib npaug) g !.

Cell kab lis kev cai thiab kev kho mob.Mouse cortical collecting duct MCD4 cells, stably qhia tib neeg AQP2 thiab chimeric V2R-Rluc tau siv los ua tus qauv sim18. Cov hlwb tau loj hlob hauv qhov sib xyaw 1: 1 ntawm Dalbec-cos hloov Eagle qhov nruab nrab thiab F-12 ntxiv nrog 5 feem pua ​​(y/y) fetal bovine serum. 1% (y/y) L-glutamine thiab 1 feem pua ​​penicillin/streptomycin, 5 μM dexamethasone, 400 ug/ml G418 (rau AQP2 resistance) thiab 1 ug/ml puromycin (rau V2R-Rluc resistance) , nyob rau hauv ib tug humidified huab cua ntawm 5 feem pua ​​CO, ntawm 37 degree . MCD4 hlwb raug tso tseg nyob rau hauv basal mob (CTR) los yog mus sij hawm ntev kho nrog OLE ntawm 0.1 mg/ml O/N, dDAVP ntawm 100 nM rau 30 min, los yog co-kho nrog OLE thiab dDAVP los yog NPS2143 ntawm l μM O/N .Txawm li cas los xij, cov hlwb raug xa mus rau 8-Br-cAMP ntawm 500 μM rau 45 min, Kev sim luv luv tau ua nrog OLE ntawm 1 mg / ml rau 5 min thiab NPS2143 ntawm 10 μM rau 15 min. Kev sim tau ua 3-5 lub sijhawm ywj pheej siv cov hlwb los ntawm cov kab lus sib txawv.

Tsiaj qauv thiab kev kho mob.Tag nrho cov txheej txheem tau ua tiav raws li kev pom zoo nrog Danish National Cov Lus Qhia rau kev saib xyuas thiab tuav cov tsiaj sim thiab cov txheej txheem luam tawm ntawm National Institutes of Health, Cov txheej txheem tau pom zoo los ntawm Lub Tsev Haujlwm Saib Xyuas Kev Kho Mob. Aarhus University, raws li cov ntawv tso cai rau kev siv cov tsiaj sim tawm los ntawm Danish Ministry of Justice (Pom zoo naj npawb 2015-15-0201-00658). Kev tshawb fawb tau ua rau cov txiv neej laus Wistar nas nrog qhov hnyav pib ntawm 200-225 g. Tsiaj txhu tau khaws cia rau ntawm tus qauv nas noj zaub mov (Altromin, Lage, Lub teb chaws Yelemees) thiab muaj kev nkag tau dawb rau cov kais dej. Thaum lub sij hawm kev sim, nas tau nyob hauv ib pawg ntawm ob lub tawb, nrog lub voj voog ntawm 12: 12 h, qhov kub thiab txias ntawm 21 ± 2 ° C, thiab av noo ntawm 55 ± 2 feem pua.

Tsib nas raug kho nrog kev txhaj tshuaj subcutaneous ntawm 1 ng dDAVP (Sigma-Aldrich, Glostrup, Denmark) hauv 200 ul saline / tsiaj txhu, thiab tsib lub tsheb-kho nas yog tswj hwm. Tom qab 30 feeb, cov nas raug tua, thiab lub raum tau ua tiav raws li tau piav qhia hauv qab no.

Cells thiab IMCD lysates.Cells tau loj hlob rau ntawm {{0}} hli cov tais diav thiab rov muab tso rau hauv qhov tsis muaj 220 mM mannitol, 70 mM sucrose, 0.5 M EGTA pH 8.0 , 0.5 M EDTA pH 8.0,1 M Tris-HCl pH 7.4 hauv

muaj cov proteases (1 mM PMSF, 2 mg / ml leupeptin, thiab 2 mg / ml pepstatin A) thiab phosphatase (10 mM NaF thiab 1 mM sodium orthovanadate) inhibitors. Alternativelv, raum seem ntawm kwv yees li 0.5 hli tau npaj thiab sib npaug rau 10 min hauv qhov tsis muaj 1i8 mM NaCl, 16 mM Hepes, 17 mM Na-Hepes, 14 mM qabzib, 3.2 mM KCl, 2.5 mM mM CaCl2, 1.8 1.8 mM KH2PO4 (pH7.4). Lub raum papilla tau minced nrog txiab nyob rau hauv tib tsis nyob rau hauv lub xub ntiag ntawm proteases (1 mM PMSF, 2 mg / mlleupeptin, thiab 2mg / mlpepstatin A) thiab phosphatase (10 mM NaF thiab 1 mM sodium. orthovanadate) inhibitors.Tom qab sonica-tion (60 kHz rau 5 s), lysates tau centrifuged ntawm 12, 000 ×g rau 10 min.Cov supernatants tau sau thiab siv rau kev tshawb fawb immunoblotting'8.

Confocal microscopy.Kev tshawb fawb Confocal tau ua raws li tau piav qhia dhau los 1. Luv luv, cov hlwb tau cog rau ntawm kab lis kev cai ntawm tes PET inserts thiab kho raws li tau piav qhia saum toj no. Xwb, lub raum seem tau txais los ntawm kev tswj hwm, OLE, dDAVP, thiab OLE nrog dDAVP cov nas kho tau raug kev sim tshuaj tiv thaiv kab mob raws li tau piav qhia yav dhau los. Cov duab tau txais nrog confocal laser-scanning fluorescence microscope Leica TCS SP2 (Leica Microsystems, Heerbrugg, Switzerland).

Gel electrophoresis thiab immunoblotting. Proteins raug cais ntawm 12 feem pua ​​​​stain-free polyacrylamide gels (Bio-Rad Laboratories, Inc., Hercules, CA, US.A.) raws li kev txo qis raws li tau piav qhia dhau los =5,52. Luv luv, cov kab protein raug xa mus rau Immobilon-P daim nyias nyias (Merck KGaA, Darmstadt, Lub teb chaws Yelemees) thiab immunoblotted siv anti-AQP2 (Pre-C-tail Ab) thiab anti-AQP2-pS256 antibodies. Immunoreactive signals tau txais kev siv Super Signal West Pico Chemiluminescent Substrates nrog Chemidoc System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).Bands tau normalized rau tag nrho cov protein uas siv cov tshuab tsis muaj stain (Bio-Rad Laboratories, Inc., Hercules.

Kev ntsuas dej permeability.Osmotic dej permeability tau ntsuas raws li tau piav qhia dhau los43. Luv luv, MCD4 hlwb tau loj hlob ntawm 40-mm iav npog. Tom qab kev kho mob, cov hlwb tau ntim nrog 10 μM membrane-permeable Calcein-AM rau 45 min ntawm 37 degree ,5 feem pua ​​CO, hauv DMEM/F-12. Cov ntawv npog tau muab tso rau hauv lub tshuab perfusion (FCS2 Kaw Chamber System, BIOPTECHS, Butler, USA). Kev ntsuas tau ua los ntawm kev siv lub tshuab hluav taws xob TE2000-S microscope (Nikon Eclipse microscope, Tokyo, Nyiv) nruab rau ib leeg-cell fluorescence ntsuas thiab imaging analysis. Calcein-AM-loaded kuaj tau zoo siab ntawm 490 nm. Kev ntsuas fluorescence, tom qab isosmotic (140 mM NaCl.5 mM KCl, 1 mM MgCl..1 mM CaCl., 10 mM Hepes sulfonic acid, 5 mM Glucose, pH7.4) lossis hyperosmotic (isosmotic kua ntxiv nrog 135 mM Mannitol) cov kev daws teeb meem . tau ua tiav siv Metafluor software (Molecular Devices, MDS Analytical Technologies, Toronto, Canada). Lub sij hawm kawm cov ntaub ntawv fluorescence tom qab perfusing hlwb nrog iso-thiab hyperosmotic daws tau raug kaw. Lub sij hawm chav kawm ntawm cell shrinkage yog ntsuas raws li lub sij hawm tas li (Ki, qhia raws li 1 / r, sec), ib tug parameter correlated rau cov dej permeability, tau los ntawm haum cov ntaub ntawv nrog ib tug exponential muaj nuj nqi soj ntsuam siv GraphPad Prism (GraphPad Software, San Diego , CA, USA).

Fluorescence resonance zog hloov kev ntsuas.Txhawm rau ntsuas cov kev hloov pauv hauv lub cev cAMP, fluorescence resonance zog hloov pauv (FRET) thev naus laus zis tau siv. Rau kev sim FRET, cov hlwb tau hloov pauv nrog plasmid encoding H96 sensor uas muaj cAMP-binding pom zoo motif ntawm EPAC1 embedded ntawm cyan fluorescent protein (CFP) thiab cp173Venus-Venus raws li yav tas los qhia32.33.54. Lub plasmid encoding H96 sojntsuam yog khoom plig los ntawm Dr.K. Jalink. Kev pom ntawm ECFP-thiab/lossis EYFP-qhia cov hlwb thiab kev tshawb pom ntawm FRET tau ua los ntawm kev siv TE2000-S microscope (Nikon Eclipse microscope, Tokyo, Nyiv). Txhua daim duab raug kho thiab tshuaj xyuas raws li tau pom yav dhau los55.

Intracellular calcium ntsuas. Intracellular calcium ntsuas tau ua raws li yav dhau los qhia56. Luv luv, MCD4 hlwb tau ntim nrog 4 μM Fura-2 AM rau 15 min ntawm 37 degree hauv DMEM/F-12. Ringer cov tshuaj siv los perfuse hlwb thaum lub sij hawm sim muaj 140 mM NaCl, 5 mM KCl 1 mM MgCl, 10 mM HEPES, 5 mM Glucose, 1.8 mM CaCl, pH 7.4. Hauv kev ntsuas fluorescence, cov npog npog nrog cov hlwb dhau los tau muab tso rau hauv chav dej perfusion (FCS2 Closed Chamber System. BIOPTECHS. Butler, USA). Kev ntsuas tau ua los ntawm kev hloov pauv TE2000-S microscope (Nikon Eclipse microscope, Tokyo. Nyiv), Qhov sib piv ntawm fluorescence intensities ntawm 340 thiab 380 nm tau npaj thiab xam raws li kev hloov pauv hauv fluorescence. Hauv particular, stimulation nrog OLE (1 mg / ml) los yog NPS2143 (10 μM) tau muab piv rau tib hom cell rau cov uas tau txais tom qab stimulation nrog ntau npaum li cas ntawm calcium-mediated agonist ATP (100 μM) uas tau siv los ua ib qho Internal tswj (100 feem pua).

Intracellular calcium theem tau ntsuas ntawm lub xeev khov kho thiab ntsuas raws li tau piav qhia los ntawm Grynkiewicz57. OLE thiab NPS2143 tau siv rau lub sijhawm ntev ntawm 0.1 mg/ml thiab l uM, raws li, thiab txhua tus qauv raug ntsuas los ntawm qhov sib ntxiv ntawm 5 μM ionomycin nyob rau hauv muaj 1 mM EGTA (Rm.) ua raws li 5 μM ionomycin hauv 5 mM CaCl, (RMA).

Kev tshawb xyuas PCR tiag tiag ntawm AQP2 thiab CaSR mRNA hauv kev tswj thiab kho nas.Kev sim PCR tiag tiag tau ua los ntsuas qhov txheeb ze ntawm mRNA nyob rau hauv lub puab medulla sau duct (IMCD) cais los ntawm kev tswj thiab kho nas raum papillae. Lub raum slices ntawm txog 0.5 hli tau tsim thiab sib npaug rau 10 min hauv qhov tsis muaj 118 mM NaCl, 16 mM HEPES, 17 mM Na-Hepes, 14 mM qabzib, 3.2 mM KCl, 2.5 mM CaCl2,1.8 mM MgSO4, thiab 1.8 mM KH2PO4 (pH 7.4). Lub raum papilla raug cais nyob rau hauv lub stereomicroscope. Cov khoom siv los ntawm kev tswj hwm thiab kho cov nas tsuag tom qab ntawd minced nrog txiab ncaj qha hauv Trizol (Thermo Fisher Scientific, Waltham, MA, USA).Reverse transcription tau ua rau 2.5 ugs ntawm tag nrho RNA siv SuperScriptVilo Master Mix (Thermo Fisher Scientific, Waltham, MA, Tebchaws Asmeskas), raws li cov chaw tsim khoom cov lus qhia (25C rau 10 min; 42C rau 60 min; 85C rau 5 min). Real-time PCR amplification tau ua los ntawm kev siv TagMan Fast Advanced Master Mix nrog CaSR, AOP2, thiab GAPDH assays (Thermo Fisher Scientific, Waltham, MA, USA) hauv StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA. ), teeb tsa lub thermal cycling tej yam kev mob raws li tau teev tseg los ntawm cov chaw tsim tshuaj paus (95 degree C rau 20 s; 40 cycles alter-natively ntawm 95·C rau 1 s thiab 60 degree C rau 20 s). Cov txiaj ntsig tau qhia raws li 2- values(relative quantification) with △ACT=(Ct target-Ct GAPDH) kho-(Ct target-Ct GAPDH)Sham1.

miRNA-137 kev soj ntsuam hauv kev tswj thiab kho nas.miRNA{{0}} cov ntsiab lus hauv kev tswj hwm thiab kho cov nas inner medulla sau cov duct tau soj ntsuam siv TagMan Advanced miRNA Assays (has-miR-137; Assay ID; 477904 mir; Thermo Fisher Scientific, Waltham, MA .US.A), uas ua rau muaj kev cuam tshuam loj heev thiab kev ceeb toom tshwj xeeb ntawm miRNA paub tab siv PCR ntau. Lub raum slices ntawm txog 0.5 hli tau tsim thiab sib npaug rau 10 min hauv qhov tsis muaj 118 mM NaCl, 16 mM HEPES, 17 mM Na-Hepes, 14 mM qabzib, 3.2 mM KCl, 2.5 mM CaCl2, 1.8 mM MgSO4, thiab KH2PO4(pH7.4).Lub raum papilla raug cais nyob rau hauv lub stereomicroscope. Cov khoom siv los ntawm kev tswj hwm thiab kho cov nas tsuag tom qab ntawd minced nrog txiab ncaj qha hauv Trizol (Thermo Fisher Scientific, Waltham, MA, USA) kom rho tawm tag nrho RNA. TaqMan Advanced miRNA cDNA Synthesis Kit (Catalog n²∶A25576; Thermo Fisher Scientific, Waltham, MA, USA) tau siv los ua kom tau txais cDNA synthesis, raws li cov txheej txheem muab los ntawm cov chaw tsim khoom (Poly(A) tailing reaction; ligation reaction; reverse transcription reaction; miR-Amp reaction). Synthetic RNA(UUAUUGCUUAAGAAGAACGUAG) nrog 59-phosphor yog synthesized los ntawm Thermo Fisher Scientific thiab siv los ua ib tug calibration nkhaus rau interpolate miRNA qauv nqi thiab kom tau ib tug meej kev ntsuam xyuas (hauv nanograms) ntawm miR-137 cov ntsiab lus nyob rau hauv samples16, los ntawm kev siv GraphPad Prism (GraphPad Software, San Diego, CA, USA).

Kev txheeb cais.Tag nrho cov txiaj ntsig tau tshaj tawm raws li txhais tau tias ± SEM Kev Tshawb Fawb Kev Tshawb Fawb tau ua los ntawm ib txoj kev ANOVA ua raws li Newman-Keuls ntau qhov kev sib piv nrog * p<0.05 considered="" statistically="" different="">

Cov lus hais, kev pom zoo rau kev ncaj ncees, thiab kev tso cai los koom.Cov kev tshawb fawb tsiaj tau ua tiav raws li kev pom zoo nrog Danish National Guidelines rau kev saib xyuas thiab tuav cov tsiaj sim thiab cov lus qhia luam tawm ntawm National Institutes of Health. Pawg Neeg Saib Xyuas Kev Ncaj Ncees ntawm Lub Tsev Haujlwm Saib Xyuas Kev Kho Mob, Aarhus University tau pom zoo cov txheej txheem kev kawm, raws li cov ntawv tso cai rau kev siv cov tsiaj sim tawm los ntawm Danish Ministry of Justice (pom zoo 2015-15-0201-00658). Cov kws sau ntawv lees paub tias txhua txoj hauv kev tau ua raws li cov lus qhia thiab cov cai. Ntxiv mus, cov kws sau ntawv lees paub tias qhov kev tshawb fawb tau ua raws li ARRIVE cov lus qhia.

Cov ntaub ntawv

1. El, SN & Karakaya, S. Txiv ntseej ntoo (Olea europaea) tawm muaj txiaj ntsig zoo rau tib neeg kev noj qab haus huv. Nutr. Rev. 67, 632–638.

2. Javadi, H., Yaghoobzadeh, H., Esfahani, Z., Reza Memarzadeh, M. & Mehdi Mirhashemi, S. Cov nyhuv ntawm txiv ntseej nplooj extract rau metabolic teb, daim siab thiab lub raum functions thiab inflammatory biomarkers nyob rau hauv cov neeg mob hypertensive. PJBS 22, 342–348.

3. Saibandith, B., Spencer, JPE, Rowland, IR & Commane, DM Olive polyphenols, thiab metabolic syndrome. Molecules

4. Cherif, S. et al. Kev sim tshuaj ntsuam xyuas ntawm titrated Olea extract hauv kev kho mob ntawm cov hlab ntsha tseem ceeb. J. Pharm. Belg. 51, 69–71 (1996).

5. Difonzo, GRA et al. Ntsuab rho tawm los ntawm cortina txiv ntseej cultivar yoojyim antioxidant characterization thiab lom lom. J. Funct. Khoom noj khoom haus 31, 8.

6. Herrero, M. et al. Cov muaj peev xwm tshiab rau qhov valorization ntawm cov roj txiv roj los ntawm cov khoom lag luam. J. Chromatogr. 1218, 7511–7520.

7. Marchetti, C. et al. Oleuropein-enriched txiv ntseej nplooj extract cuam tshuam calcium dynamics thiab impairs viability ntawm malignant mesothelioma hlwb. eCAM 2015, 908493.

8. Romero, M. et al. Antihypertensive teebmeem ntawm oleuropein-enriched txiv ntseej nplooj extract nyob rau hauv spontaneously hypertensive nas. Food Function 7, 584–593.

9. Hall, JE lub raum tsis ua haujlwm, tsis yog lub raum tsis ua haujlwm. Mediates ntsev-induced hypertension. Phau Ntawv Nkauj 133, 894–906.

10. Wilson, JL, Miranda, CA & Knepper, MA Vasopressin thiab txoj cai ntawm aquaporin-2. Clin. Exp. Nephrol. 17 Ib., 751–764.

11. Procino, G. et al. Extracellular calcium antagonize forskolin-induced aquaporin 2 kev lag luam hauv kev sau cov ducts. Raum Int. 66, 2245–2255.

12. Riccardi, D. & Valenti, G. Localization thiab kev ua haujlwm ntawm lub raum calcium-sensing receptor. Ntuj tshuaj xyuas. Nephrology 12, 414–425.

13. Di Muas, A. et al. Conditionally immortalized human proximal tubular epithelial cells cais tawm ntawm cov zis ntawm ib qho kev noj qab haus huv qhia txog kev ua haujlwm calcium-sensing receptor. Am. J. Physiol. Lub raum Physiol. 308, F1200-1206, ib.